...
1380 aa
1-60 RuvCI nuclease (Constant position)
60-94 Arginine rich helix (Rotates from APO to sgRNA bound)
94-167 RecI (Rotates from APO to sgRNA bound)
167-307 RecII (Rotates from APO to sgRNA bound)
307-447 RecI (Rotates from APO to sgRNA bound)
447-718 RecIII (Rotates from APO to sgRNA bound) (Conformational changes in 4zt0 4zt9 5xbl)
718-765 RuvCII nuclease (Constant position)
765-909 HNH endonuclease (Two distinct conformations)
909-1099 RuvCIII nuclease (Constant position)
1099-1368 PAM-interacting domain (PI) (Constant position)
sgRNA
120 RNA
5'-GGCGCATAAAGATGAGACGCGTTTTAGAGCTATGCTGTTTTGAAAAAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTCG-3'
...
3'-CCGCGTATTTCTACTCTGCGACCGCTAATC-5'
Details on the mechanism