from PDB: 5f9r
1380 aa
1-60 RuvCI nuclease (Constant position) (iceblue)
60-94 Arginine rich helix (Rotates from APO to sgRNA bound) (mauve)
94-167 RecI (Rotates from APO to sgRNA bound) (white)
167-307 RecII (Rotates from APO to sgRNA bound) (yellow)
307-447 RecI (Rotates from APO to sgRNA bound) (silver)
447-718 RecIII (Rotates from APO to sgRNA bound) (Conformational changes in 4zt0 4zt9 5xbl) (blue2)
718-765 RuvCII nuclease (Constant position) (cyan2)
765-909 HNH endonuclease (Two distinct conformations) (green)
909-1099 RuvCIII nuclease (Constant position) (cyan3)
1099-1368 PAM-interacting domain (PI) (Constant position) (red)
120 RNA
5'-GGCGCATAAAGATGAGACGCGTTTTAGAGCTATGCTGTTTTGAAAAAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTCG-3'
1-20 guide
10-20 seed
1-41 crRNA
46-118 tracrRNA
30 dsDNA
5'-GGCGCATAAAGATGAGACGCTGGCGATTAG-3'
3'-CCGCGTATTTCTACTCTGCGACCGCTAATC-5'
Details on the mechanism
http://sites.tufts.edu/crispr/crispr-mechanism