Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.
Comment: Migrated to Confluence 5.3

 

Description

Download PhyloNet

  • Co-estimation of reticulate phylogenies (ILS & hybridization) and , gene trees, divergence times and population sizes on sequences from multiple independent loci.

    Usage

     

    MCMC_

    Usage

     

    MCMC_SEQ -loci locusList [-cl chainLength] [-bl burnInLength] [-sf sampleFrequency] [-sd seed] [-pl parallelThreads] [-dir OutDirectoryoutDirectory] [-mc3 temperatureList] [-mr maxReticulation] [-tm taxonMap] [-fixps popSize] [-varyps] [-pp poissonParameter] [-dd] [-ee] [-sgt startingGeneTrees] [-snet startingNetwork] [-sps startingPopSize] [-pre preBurnIn] [-gtr paramList] [-diploid diploidSpeciesList]startingPopSize] [-pre preBurnIn] [-gtr paramList] [-diploid diploidSpeciesList] [-murate] [-mupi paramList] [-muweight paramList]



    MCMC Settings
    -loci locusListThe list of loci used in the inference. For example, -loci (YNR008W,YNL313C) indicates the inference is performed on two loci YNR008W and YNL313C. See the format of multilocus data here. Note that our method is able to handle missing data, see the example below.optional

    -cl chainLength

    The length of the MCMC chain. The default value is 10,000,000.

    optional

    -bl burnInLengthThe number of iterations in burn-in period. The default value is 2,000,000.optional

    -sf sampleFrequency

    The sample frequency. The default value is 5,000.

    optional

    -sd seedThe random seed. The default seed is 12345678.optional
    -pl parallelThreads The number of threads running in parallel. The default value is the number of threads in your machine.optional
    -dir outDirectoryThe absolute path to store the output files. The default path is your home directory.optional
    MC3 Settings
    -mc3 temperatureList

    The list of temperatures for the Metropolis-coupled MCMC chains. For example, -mc3 (2.0, 3.0) indicates two hot chains with temperatures 2.0 and 3.0 respectively will be run along with the cold chain with temperature 1.0. By default only the cold chain will be run. Note that

    • The temperatures should be DIFFERENT! For example, -mc3 (2.0, 2.0, 3.0) is invalid.
    • The temperature of the cold chain should NOT be included. For example, -mc3 (1.0, 2.0, 3.0) is incorrect.
    • Metropolis-coupled MCMC leads to faster convergence and better mixing, however, the running time increases linearly with the number of chains. We suggest you first run a standard MCMC chain (cold chain) without this command. If the trace plot indicates the chain is not mixed well (jagged, stuck in local maxima for a long time), then try this command.
    optional
    Inference Settings
    -mr maxReticulationThe maximum number of reticulation nodes in the sampled phylogenetic networks. The default value is 4.optional
    -tm taxonMapGene tree / species tree taxa association. By default, it is assumed that only one individual is sampled per species in gene trees. This option allows multiple alleles to be sampled. For example, the gene tree is (((a1,a2),(b1,b2)),c); and the species tree is ((a,b),c);, the command is -tm <a:a1,a2; b:b1,b2;c:c>. Note that the taxa association should cover all species, e.g. -tm <a:a1,a2; b:b1,b2> is incorrect because c:c is dropped out. optional
    -fixps popSizeFix the population sizes associated with all branches of the phylogenetic network to this given value. By default, we estimate a constant population size across all branches.optional
    -varypsVary the population sizes across all branches. By default, we estimate a constant population size across all branches.

    optional

    -murateEnabling the delta exchange operator for modeling varying substitution rates across loci.optional
    Prior Settings
    -pp poissonParamThe Poisson parameter in the prior on the number of reticulation nodes. The default value is 1.0.

    optional

    -ddDisable the prior on the diameters of hybridizations. By default this prior on is exp(10).optional
    -eeEnable the Exponential(10) prior on the divergence times of nodes in the phylogenetic network. By default we use Uniform prior.optional
    Starting State Settings
    -sgtSpecify the starting gene trees for each locus. Comma delimited list of gene tree identifiers. See details. The gene trees should be ultrametric trees with coalescent times in units of expected number of mutations per site. See example below. The default starting gene trees are UPGMA trees.optional
    -snetSpecify the starting network. The input network should be ultrametric with divergence times in units of expected number of mutations per site, inheritance probabilities and population sizes in units of population mutation rate (optional). See example below. The default starting network is the MDC trees given starting gene trees. optional
    -spsSpecify the starting population size. The default value is 0.02
    MCMC Settings
    -loci locusListThe list of loci used in the inference. For example, a list (YNR008W,YNL313C) indicates the inference is performed on two loci YNR008W and YNL313C. See the format of multilocus data here. Note that our method is able to handle missing data, see the example below.optional

    -cl chainLength

    The length of the MCMC chain. The default value is 1,000,000.

    optional

    -bl burnInLengthThe number of iterations in burn-in period. The default value is 200,000.optional

    -sf sampleFrequency

    The sample frequency. The default value is 5,000.

    optional

    -sd seedThe random seed. The default seed is 12345678.optional
    -pl parallelThreads The number of threads running in parallel. The default value is the number of threads in your machine.optional
    -dir outDirectoryThe absolute path to store the output files. The default value is the home directory.optional
    MC3 Settings
    -mc3 temperatureListThe list of temperatures for the Metropolis-coupled MCMC chains. For example, a list (2.0, 3.0) indicates two hot chains with temperatures 2.0 and 3.0 respectively will be run along with the cold chain with temperature 1.0. By default only the cold chain will be run.optional
    Inference Settings
    -mr maxReticulationThe maximum number of reticulation nodes in the sampled phylogenetic networks. The default value is 4.optional
    -tm taxonMapGene tree / species tree taxa association. By default, it is assumed that only one individual is sampled per species in gene trees. However, this option allows multiple alleles to be sampled.optional
    -fixps popSizeFix the population sizes associated with all branches of the phylogenetic network to this given value. By default, we estimate a constant population size across all branches.optional
    -varypsVary the population sizes across all branches. By default, we estimate a constant population size across all branches.optional
    Prior Settings
    -pp poissonParamThe Poisson parameter in the prior on the number of reticulation nodes. The default value is 1.0

    optional

    -ddDisable the prior on the diameters of hybridizations. By default this prior on is exp(10).optional
    -eeEnable the Exponential(10) prior on the divergence times of nodes in the phylogenetic network. By default we use Uniform prior.optional
    Starting State Settings
    -sgtSpecify the starting gene trees. Comma delimited list of gene tree identifiers. See details. The default starting gene trees are UPGMA trees. See example below.optional
    -snetpreSpecify the starting network. The default starting network is the MDC trees given starting gene trees. See example belownumber of iterations for pre burn-in, e.g. "-pre 20" means 20x sampleFrequency iterations will be run before the MCMC chain starts. By default, we run 10x sampleFrequency iterations for pre burn-in. optional

    Substitution Model

    -spsSpecify the starting population size. The default value is 0.036. See example below.optional
    -preSpecify the number of iterations for pre burn-in, e.g. "-pre 20" means 20x sampleFrequency iterations will be run before the MCMC chain starts. By default, we run 10x sampleFrequency iterations for pre burn-in.optional

    Substitution Model

    -gtr paramListSet GTR (general time-reversible) as the substitution model. The first four parameters in the list represent base frequencies for A, C, G, T. The rest six parameters represent transition probabilities for A>C, A>G, A>T, C>G, C>T and G>T. The default substitution model is JC69 model.optional
    Phasing
    -diploid diploidSpeciesListIntegrates over all possible phasings of heterozygous genotypes when computing likelihoods [2] given diploid species list. For example, a list of (Scer, Spar) indicates species Scer and Spar will be treated as diploid species in likelihood computation. See Section S4 in G-PhoCS manual for full details. By default we assume the sequences come from haploid species, or the sequences are randomly phased. Note that the substitution model is set to JC69 (fixed).optional

    Simple Example

    gtr paramListSet GTR (general time-reversible) as the substitution model. The first four parameters in the list represent base frequencies for A, C, G, T. The rest six parameters represent transition probabilities for A>C, A>G, A>T, C>G, C>T and G>T. The default substitution model is JC69 model.optional
    Phasing
    -diploid diploidSpeciesListIntegrates over all possible phasings of heterozygous genotypes when computing likelihoods [2] given diploid species list. For example, a list of (Scer, Spar) indicates species Scer and Spar will be treated as diploid species in likelihood computation. See Section S4 in G-PhoCS manual for full details. By default we assume the sequences come from haploid species, or the sequences are randomly phased. Note that the substitution model is set to JC69 (fixed).optional
    Substitution rate sampling 
    -mupi paramListSpecify the substitution rates when sampling locus-specific substitution rates, which are a list of double values with the order of loci in the nexus file. The default value for all loci is 1.0. 
    -muweight paramListSpecify the weights for substitution rates when sampling locus-specific substitution rates, which are a list of integer values with the order of loci in the nexus file. The default value for all loci is 1. 

    Simple Example

    Download: MCMCseq_example0.nex

    Please don't copy and paste, since some illegal characters might be copied.

    Code Block
    htmllang
    #NEXUS 
    Begin data;
    	Dimensions ntax=5 nchar=80;
    	Format datatype=dna symbols="ACTG" missing=? gap=-;
    	Matrix
    [YAL053W, 25, ...]
    Scer TCTTTATTGACGTGTATGGACAATT
    Spar TCTTTGTTAACGTGCATGGACAATT
    Smik TCCTTGCTAACATGCATGGACAATT
    Skud TCTTTGCTAACGTGCATGGATAATT
    Sbay TCTTTACTAACGTGCATGGATAACT
    [YAR007C, 30, ...]
    Scer ATGAGCAGTGTTCAACTTTCGAGGGGCGAT
    Spar ATGAGCAGCGTTCAACTTTCGAAGGGCGAC
    Smik ATGAGCAGCGTGCAACTATCAAAGGGCGAC
    Skud ATGAGCAGTGTTCAACTTTCGAAGGGCGAC
    Sbay ATGAGCAGCGTTCAACTTTCGAAGGGCGAC
    [YBL015W, 25, ...]
    Scer TCTAATTTGTTAAAGCAGAGAGTTA
    Spar TCTAATTTGTTAAAGCAGAGAGTTA
    Smik TCTAATTTGTTAAAACAGAGAGTTC
    Skud TCTAATCTGTTGAAGCAGAGAGTTA
    Sbay TCTAATCTGTTGAAGCAAAAAGTCA
    ;End;
    BEGIN PHYLONET;  
    MCMC_SEQ -cl 250000 -bl 50000 -sf 5000;
    END;

     

     

    Example with Starting State

    Download:

    MCMCseq_example1.nex

    Please don't copy and paste, since some illegal characters might be copied.

    Example with Starting State

    Code Block
    htmllang
    #NEXUS 
    
    Begin data;
    	Dimensions ntax=3 nchar=500;
    	Format datatype=dna symbols="ACTG" missing=? gap=-;
    	Matrix
    [0, 500]
    A TCGCGCTAACGTCGTTTATAAGTGATCAAAGATAAAAGGAAATCTAAGCTGCCTTCATGTTCCTCATCGGACCTGCACAAGGATGGGCGTGGAGATTCTGGCATGGATACTGTACTTTTACGCGATCGCCCCAGCTACCGACCTCTATAATCACAGGGAATCTCGGGGAACGAATTGCTTCACTAGGTCACACCCGGTTTATAGCCCGTAGAAGTTAGAGCCCGCGAATAAAGGACTAACAACTCTTATCAAGCTAAGGGACATCCTAGAGGGACCTCTGCGGGAGCAGCATGTTGTGTGACTCATCACGGTAAGAACTTGGCAAGCGCGACAGCGGCTAAGCCAGCATGCTAGGCGTCGTCGGATAGTCGCCGTCACGGAATCGGATGAGATCCCTTGAGGGATTGATGATGTTCACATCACTACATGGTTGTTCTGAGTGTTGGTGATCAGGTGCAGCAATTGTGCTTGACGGAAATGGGCTCTCATAACCGAACCCA
    C GCGCACCTCCCTCGGATATAAGTGACCGAAGAGAAAAGGGAATCTAATTGGCCCTATCATCACTCATCGTACCTGATCACGTATGGCTGTGGAGATTGCGGCATGGATACTGTACTTTTGAGCGATCATCCCAGTTACCGACCTTCTTAATAAGAGGGAACCTAGGGTAAAGGAATGCTCCACTCCGTCACACGGGGTATATATCCGGAATATGTTAGGCCCCCCGAATGAAGGAGTAAAAACTCTTAACAAGCTCCGACAGATCCTAGGGTATCGTCTGCGGGGCCGGCAGGTCGTGGGACGCATCACGCTAAACACTTGGCAAGCGTGACAGCGGCTGGGTCAGAATGCTCGGCCACGCCGTTTAGTCGCCGGCACCGAATCGAATGTGATCCCTTGAGGAAATGATGAAGTTAACATCATTACATGGGTGCTCTGAGTGATGGTGATAAGGTGGAGGACTTGTGTTTGACGGAAATGGGCTCTGAAAACCGAACTCT
    B GCGCACCTACTGCGGATATAAGTGACCGAAGAGTAATGGGAATCTATGCGGCCCTCGCGTCTCTCATCGTACCTGATCAAGTATGGGCGTGGAGATTGTGGCATGGATACTGTACTTTTGAGCCATCATCCCAGTTACCGACCTTCGTAATAAGAGCGAGCCTAGGGGAAAGAAATGCTCCACTCCATCACACCGGGTATATATCCGGAATATGTTCGAGCCCCCGAATAAAGGAGTAAAAACTCTTAACAAGCTCCGAAACATCCTAGGGTATCCTCTGCAGGGACGGCATGTTGTGGGGCCCATCACCCTAAGACCTTTGCAAGCATGAAAGCGGCTCAGCCAGCATGCTCGATCCCGCCGTACAGTCGCCGGCACGGAATCGAGTGTGATCCCCTGAGGAATTGATGAAGTTAACATCACTACTTGGCTGCTCTGAGTGCTGGTGATCAGGTGCAGCACATATGTGTGACGGAAATGGGCACTGACAACCGAACTAT
    [1, 500]
    A GAAACGGATCTAAGTGTACGGTTTCTCTCGAAGGGGGCACCTTTGCTATGCCCACCCCCATCTTGGAAGTGCGAGACCATACTCGCGCGTGCGTCAGGTTCTTACTTGATTTCGGCGGGGGTGGCTAAATTTTAGCTAGGGATCTAGAAATCCGTCATAGTCCTACAGGGCCATTCTGCCGCTTGCTAGCGTTGGTGATACGAGGGCAACTTTGAACTTTACGCGGAACTCCCCACCTCAGAGACTGTTACGACGTAGGCTAAATGTGCCGTGATTTCTGAGGGCAAAAGCCGTGCAAGGATGGACGGGGGTGCTCAAACAACTGCATCAGCCTCGGCATTATCTTGCATGAGCGCCTTCGATCGGTCACCAGTCGGCTAGATTACAAGCAAGCTCTTCGGAGGAGATGAGCTCGCATGGATCACGCGTCTACGTAACTTTCAGGGTCCATCCAAATGTCAATCATTCACCGAATGGCGATCGTCAGGTACGCGATTCCA
    C CGCTCGGATCTAAGTGTACGGTTTCTCTCGAAGGTGGAACCATTGCTATACCCACCCCCATCTTGGAAGTGCCAAACCATTCTCCCAAGAGCGTCGGGTTCTTACTCGATTTCGGCGGGGGTGGCTACAATTTAGGTAGGGATCTAGAAATCGGTTATAATCCTACAAAGCCATTCTGGCGCTTGCTAGTGTTGGTGATACGAGGGCAGCTTTGAACTTTACCGGGAACTGGGCACCTAAGGGACTGTGTCGACGTAGGCTAAATGTGCCGTGATTTCAGCGAGCAAAAGCCATGCAAGATTGGACGGGGGGCCTCAAACAACTGCATCAGCCTCGATATTATCTTGCATGAGCTCCTTCGATCGGTTCCCAGTCGGCTATATTATAAGCAAGCTCTTCGGAGGATATGAGCACGCACGGATTCCGCGTCTACGTAACTTTGAGGGCCCAGCCAGCAGTCAATCATTCAACGAATGGCGATCATAACGAACGCGATTCCA
    B CGCTCGGATCTAAGTGTACGGTTTCTCTGGAAGGTGGAACCATTGCTATACCCATCCCCATCTTGGAAGTGCCAGACCATTCTCCCAAGAGCGTCTGGTTCTTACTCGATTTCGGCGGGGGTGGCTACAATTTAGGTAGGGATCTAGAAATCGGTGATAATCGTACAAAGCCATTCTGGCGCTTGCTAGTGTCGGTGATACGAGAGCAGCTTTGAACTTTACCCGGAACTGCGCACCTAAGGGACTGTGTCGACGTAGGCTAAATGTGCCGTGATTTCAGCGAGCAAAAGCCATGCAAGATTGGACGGGCGGCCTCAAACAACTGCATCAGCCTCGATATTATCTTGCATGAGCTCCTTCGATCGGTTCCCAGTCGGCTATCTTATAAGCAAGCTCTTCGGAGGATATGAGCACGCACGGATTCCGCGTCTACGTAACTTTGAGGGCCCAGCCAGCAGTCAATCATTGACCGAATGGCGATCATAACGAACGCGATTCCA
    ;End;
    
    BEGIN TREES;
    Tree gt0 = (A:0.119900443,(C:0.058838639,B:0.058838639):0.061061803);
    Tree gt1 = (A:0.068766378,(C:0.016229589,B:0.016229589):0.052536789);
    END;
    
    BEGIN NETWORKS;
    Network net1 = (((B:0.0)I3#H1:0.05::0.8,(C:2.0E-8,I3#H1:2.0E-8::0.2)I2:0.04999998)I1:0.01,A:0.06)I0;
    END;
    
    BEGIN PHYLONET;  
    MCMC_SEQ -cl 50000 -bl 10000 -sgt (gt0,gt1) -snet (net1) -sps 0.04 -pre 20;
    END;END;

     

     Example given Missing Data

    Please don't copy and paste, since some illegal characters might be copied.

     

    Example given Missing Data

    Code Block
    htmllang
    #NEXUS 
     
    Begin data;
    	Dimensions ntax=5 nchar=108;
    	Format datatype=dna symbols="ACTG" missing=? gap=-;
    	Matrix
    [loci1, 53, ...]
    a1	ATTGGAGACRAGCGARGACCGAGCTCACGAACCTGAGGAATGGAATCGATTAC
    a2	ATTTGAGACRAGCGARGACCGAGCTCACGAACCTGAGGANTGGAATCGATTAC
    b1	TTGGGAGACGAGCGAAGACAGAGCATATGAGCCTAAGGATTGGAATCGATTGT
    b2	TTGGGAGACGAGCGAAGACAGAGCATATGAGCCTGAGGATTGGAATCGATTGT
    [loci2, 58, ...]
    a2	ACTTTGCAAGCCAAAAATGGTATGCGAGACAACGCCTGTCATGGATGATGAACCAGAT
    b1	GCTTTGCAAGCCTAAGATGGTTTGCGAGACGACGATGGCAGTCGACGATGAATCAGAC
    b2	GCTTTGCAAGCCTAAGATGGTTTGCGAGACGACGATGGCAGTCGACGATGAATCAGAC
    c1	GCTTTGRAAGRCAAAAATGATATGCGAAACAACGCCCGTGATGGACGATGAACAGGAT
    ;End;
    BEGIN PHYLONET;  
    MCMC_SEQ -loci (loci1,loci2) -cl 5000000 -bl 1000000 -tm <A:a1,a2; B:b1,b2; C:c1>;
    END;



    Understanding the Output

    System Output

    • Logger: each time a sample is collected, the program prints out out 
      1. first line: the Posterior value, current ESS (Effective Sample Size) based on the posterior values, likelihood value, prior value, current ESS based on the prior values.
      2. second line: the sampled phylogenetic network, with divergence times, population sizes and
      the sampled phylogenetic network. Note the value in the brackets is the
      1. inheritance probabilities. Note that the value in the bracket is the population size of the root branch. If a constant population size across all branches is assumed, then the value represents the general population size.
    • Summarization: the program prints out the chain length, burn-in length, sample frequency and the overall acceptance rate of proposals.
    • Operations: the usage and the acceptance rate for each operation.
    • 95% credible set of network topologies:Topologies: the
      • size: the number of times the topology being sampled
      • percent: the proportion of the topology being sampled
      • MAP (Maximum A Posterior)
      topology is given. For each unique topology, the network with the maximum
      • : the maximum posterior value and the corresponding topology the MAP topology are given. 
      • AVE: the average posterior value and the averaged (branch lengths and inheritance probabilities) network are printed out.
      The
      •  
      • rank: the topologies are ranked on their
      posterior probabilities
      • proportion.
    • Run time: the elapsed time.

     

    MCMC_SEQ -cl 250000 -bl 50000 -sf 5000

    ----------------------- Logger: -----------------------
    Iteration; Posterior; ESS; Likelihood; Prior; ESS; #Reticulation
    0; -257.55069; 0.00000; -263.27861; 5.72791; 0.00000; 0;
    [0.036]((((Scer:0.00857375,Spar:0.00857375):4.5125000000000026E-4,Skud:0.009025):4.7499999999999973E-4,Sbay:0.0095):0.11472678834065418,Smik:0.12422678834065418);
    ......
    50; -176.50732; 10.65831; -181.15553; 4.64822; 11.84238; 0;
    [0.017160158027924775](((Sbay:0.01968119866828454,Skud:0.01968119866828454):0.042016035724419504,(Spar:0.04364900393745317,Scer:0.04364900393745317):0.018048230455250877):0.01662669337541752,Smik:0.07832392776812157);
    ----------------------- Summarization: -----------------------
    Burn-in = 50000, Chain length = 250000, Sample size = 40, Acceptance rate = 0.10274
    --------------- Operations ---------------
    Operation:NarrowNNI; Used:34781; Accepted:3750 ACrate:0.10781748655875334
    Operation:Swap-Nodes; Used:5273; Accepted:155 ACrate:0.02939503129148492
    Operation:SubtreeSlide; Used:34904; Accepted:3566 ACrate:0.10216594086637634
    ......

    Overall MAP = -139.6655535361708

    (((Spar:0.054401097303896875,Scer:0.054401097303896875):0.02940261095452569,Smik:0.08380370825842257):0.015640290731517764,(Sbay:0.038489186677349164,Skud:0.038489186677349164):0.060954812312591165);
    -------------- Top Topologies95% credible set: --------------
    Rank = 0; Size = 20; Percent = 048.48780478; MAP = -139.6655535361708:(((Spar:0.054401097303896875,Scer:0.054401097303896875):0.02940261095452569,Smik:0.08380370825842257):0.015640290731517764,(Sbay:0.038489186677349164,Skud:0.038489186677349164):0.060954812312591165); Ave=-159.81967227297005; ((Smik:0.07802648460532205,(Scer:0.04734369459293139,Spar:0.04734369459293139):0.03068279001239066):0.012243968912293374,(Skud:0.0399365140411103,Sbay:0.0399365140411103):0.05033393947650512);
    Rank = 1; Size = 16; Percent = 039.39024302; MAP = -150.1407504811838:(Smik:0.08832671142241318,((Sbay:0.0574884656789708,Skud:0.0574884656789708):0.029947862652692656,(Spar:0.05271204611595535,Scer:0.05271204611595535):0.034724282215708106):8.903830907497218E-4); Ave=-171.0422748749801; (Smik:0.09785346027572299,((Sbay:0.040857883347008524,Skud:0.040857883347008524):0.03552943228704832,(Scer:0.055009891356695276,Spar:0.055009891356695276):0.02137742427736157):0.021466144641666143);
    ......

    Total elapsed time : 27.35100 s

    Sample Files

    The phylogenetic network, gene trees and the hyper-parameter of the population size are logged into files under your home directory or the directory specified by "-dir outDirectory".

    • Phylogenetic Network: ~/outDirectory/network.log
    • Hyper-parameter of Population size: ~/outDirectory/popSizePrior.log
    • Gene tree: ~/outDirectory/tree_locusName.log

    Downloads

    • example.zip
      • example.nexus: input file for PhyloNet
      • example.txt: system output
      • network.log, popSizePrior.log, tree_YAL053W.log, tree_YAR007C.log, tree_YBL015W.log: sample files
    • The yeast data set (Rokas et al., 2003) sampled from seven Saccharomyces species S. cerevisiae (Scer), S. paradoxus (Spar), S. mikatae (Smik), S. kudriavzevii (Skud), S. bayanus (Sbay), S. castellii (Scas) and S. kluyveri (Sklu)
      • 106-locus
      • 28-locus (with strong phylogenetic signals)
      • 106-locus restricted by five Saccharomyces species ScerSparSmikSkud and Sbay.
    • The wheat data set (Marcussen et al., 2014) sampled from hexaploid bread wheat subgenomes T. aestivum TaA (A subgenome), TaB (B subgenome) and TaD (D subgenome), and five diploid relatives T. monococcum (Tm), T. urartu (Tu), Ae. sharonensis (Ash), Ae. speltoides (Asp) and Ae. tauschii (At)
    • The mosquito data set (Fontaine et al., 2014) sampled from six Anopheles species An. gambiae (G), An. coluzzii (C), An. arabiensis (A), An. quadriannulatus (Q), An. merus (R) and An. melas (L)
      • 228-locus from X chromosome
      • 59-locus (with strong phylogenetic signals) from X chromosome
      • 382-locus (with strong phylogenetic signals) from autosomes

    Visualization

     

    If you want to analyze parameters in the sampled networks using Tracer, please use command SummarizeMCMCResults to generate Tracer readable log file.

    Command References

    1. D.Wen and L. Nakhleh. Co-estimating reticulate phylogenies and gene trees on sequences from multiple independent loci. Submitted
    2. Gronau, Ilan, et al. Bayesian inference of ancient human demography from individual genome sequences. Nature genetics 43.10 (2011): 1031-1034.

    See Also