...

1-60 RuvCI nuclease           (Constant position) (iceblue)

60-94 Arginine rich helix      (Rotates from APO to sgRNA bound) (mauve)

94-167 RecI                         (Rotates from APO to sgRNA bound) (white)

167-307 RecII                       (Rotates from APO to sgRNA bound) (yellow)

307-447 RecI                        (Rotates from APO to sgRNA bound) (silver)

447-718 RecIII                      (Rotates from APO to sgRNA bound) (Conformational changes in 4zt0 4zt9 5xbl) (blue2)

718-765 RuvCII nuclease     (Constant position)  (cyan2)

765-909 HNH endonuclease  (Two distinct conformations) (green)

909-1099 RuvCIII nuclease     (Constant position) (cyan3)

1099-1368 PAM-interacting domain (PI) (Constant position) (red)

sgRNA

120 RNA

5'-GGCGCATAAAGATGAGACGCGTTTTAGAGCTATGCTGTTTTGAAAAAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTCG-3'

...