You are viewing an old version of this page. View the current version.

Compare with Current View Page History

« Previous Version 40 Next »

Description

Usage

 

MCMC_SEQ -loci locusList [-cl chainLength] [-bl burnInLength] [-sf sampleFrequency] [-sd seed] [-pl parallelThreads] [-dir OutDirectory] [-mc3 temperatureList] [-mr maxReticulation] [-tm taxonMap] [-fixps popSize] [-varyps] [-pp poissonParameter] [-dd] [-ee] [-gtr paramList] [-diploid diploidSpeciesList]



MCMC Settings
-loci locusListThe list of loci used in the inference. For example, a list (YNR008W,YNL313C) indicates the inference is performed on two loci YNR008W and YNL313C. See the format of multilocus data here.optional

-cl chainLength

The length of the MCMC chain. The default value is 1,000,000.

optional

-bl burnInLengthThe number of iterations in burn-in period. The default value is 200,000.optional

-sf sampleFrequency

The sample frequency. The default value is 5,000.

optional

-sd seedThe random seed. The default seed is 12345678.optional
-pl parallelThreads The number of threads running in parallel. The default value is the number of threads in your machine.optional
-dir outDirectoryThe absolute path to store the output files. The default value is the home directory.optional
MC3 Settings
-mc3 temperatureListThe list of temperatures for the Metropolis-coupled MCMC chains. For example, a list (2.0, 3.0) indicates two hot chains with temperatures 2.0 and 3.0 respectively will be run along with the cold chain with temperature 1.0. By default only the cold chain will be run.optional
Inference Settings
-mr maxReticulationThe maximum number of reticulation nodes in the sampled phylogenetic networks. The default value is 4.optional
-tm taxonMapGene tree / species tree taxa association. By default, it is assumed that only one individual is sampled per species in gene trees. However, this option allows multiple alleles to be sampled.optional
-fixps popSizeFix the population sizes associated with all branches of the phylogenetic network to this given value. By default, we estimate a constant population size across all branches.optional
-varypsVary the population sizes across all branches. By default, we estimate a constant population size across all branches.optional
Prior Settings
-pp poissonParamThe Poisson parameter in the prior on the number of reticulation nodes. The default value is 1.0

optional

-ddDisable the prior on the diameters of hybridizations. By default this prior on is exp(10).optional
-eeEnable the Exponential(10) prior on the divergence times of nodes in the phylogenetic network. By default we use Uniform prior.optional
Substitution Model
-gtr paramListSet GTR (general time-reversible) as the substitution model. The first four parameters in the list represent base frequencies for A, C, G, T. The rest six parameters represent transition probabilities for A>C, A>G, A>T, C>G, C>T and G>T. The default substitution model is JC69 model.optional
Phasing
-diploid diploidSpeciesListIntegrates over all possible phasings of heterozygous genotypes when computing likelihoods [2] given diploid species list. For example, a list of (Scer, Spar) indicates species Scer and Spar will be treated as diploid species in likelihood computation. See Section S4 in G-PhoCS manual for full details. By default we assume the sequences come from haploid species, or the sequences are randomly phased. Note that the substitution model is set to JC69 (fixed).optional

Examples

#NEXUS 
Begin data;
	Dimensions ntax=5 nchar=80;
	Format datatype=dna symbols="ACTG" missing=? gap=-;
	Matrix
[YAL053W, 25, ...]
Scer TCTTTATTGACGTGTATGGACAATT
Spar TCTTTGTTAACGTGCATGGACAATT
Smik TCCTTGCTAACATGCATGGACAATT
Skud TCTTTGCTAACGTGCATGGATAATT
Sbay TCTTTACTAACGTGCATGGATAACT
[YAR007C, 30, ...]
Scer ATGAGCAGTGTTCAACTTTCGAGGGGCGAT
Spar ATGAGCAGCGTTCAACTTTCGAAGGGCGAC
Smik ATGAGCAGCGTGCAACTATCAAAGGGCGAC
Skud ATGAGCAGTGTTCAACTTTCGAAGGGCGAC
Sbay ATGAGCAGCGTTCAACTTTCGAAGGGCGAC
[YBL015W, 25, ...]
Scer TCTAATTTGTTAAAGCAGAGAGTTA
Spar TCTAATTTGTTAAAGCAGAGAGTTA
Smik TCTAATTTGTTAAAACAGAGAGTTC
Skud TCTAATCTGTTGAAGCAGAGAGTTA
Sbay TCTAATCTGTTGAAGCAAAAAGTCA
;End;
BEGIN PHYLONET;  
MCMC_SEQ -cl 250000 -bl 50000 -sf 5000;
END;


Understanding the Output

System Output

  • Logger: each time a sample is collected, the program prints out the Posterior value, current ESS (Effective Sample Size) based on the posterior values, likelihood value, prior value, current ESS based on the prior values, and the sampled phylogenetic network. Note the value in the brackets is the population size.
  • Summarization: the program prints out the chain length, burn-in length, sample frequency and the overall acceptance rate of proposals.
  • Operations: the usage and the acceptance rate for each operation.
  • Topologies: the MAP (Maximum A Posterior) topology is given. For each unique topology, the network with the maximum posterior value and the averaged (branch lengths and inheritance probabilities) network are printed out. The topologies are ranked on their posterior probabilities.
  • Run time: the elapsed time.

 

MCMC_SEQ -cl 250000 -bl 50000 -sf 5000

----------------------- Logger: -----------------------
Iteration; Posterior; ESS; Likelihood; Prior; ESS; #Reticulation
0; -257.55069; 0.00000; -263.27861; 5.72791; 0.00000; 0;
[0.036]((((Scer:0.00857375,Spar:0.00857375):4.5125000000000026E-4,Skud:0.009025):4.7499999999999973E-4,Sbay:0.0095):0.11472678834065418,Smik:0.12422678834065418);
......
50; -176.50732; 10.65831; -181.15553; 4.64822; 11.84238; 0;
[0.017160158027924775](((Sbay:0.01968119866828454,Skud:0.01968119866828454):0.042016035724419504,(Spar:0.04364900393745317,Scer:0.04364900393745317):0.018048230455250877):0.01662669337541752,Smik:0.07832392776812157);
----------------------- Summarization: -----------------------
Burn-in = 50000, Chain length = 250000, Sample size = 40, Acceptance rate = 0.10274
--------------- Operations ---------------
Operation:NarrowNNI; Used:34781; Accepted:3750 ACrate:0.10781748655875334
Operation:Swap-Nodes; Used:5273; Accepted:155 ACrate:0.02939503129148492
Operation:SubtreeSlide; Used:34904; Accepted:3566 ACrate:0.10216594086637634
......

Overall MAP = -139.6655535361708

(((Spar:0.054401097303896875,Scer:0.054401097303896875):0.02940261095452569,Smik:0.08380370825842257):0.015640290731517764,(Sbay:0.038489186677349164,Skud:0.038489186677349164):0.060954812312591165);
-------------- Top Topologies: --------------
Rank = 0; Size = 20; Percent = 0.487804; MAP = -139.6655535361708:(((Spar:0.054401097303896875,Scer:0.054401097303896875):0.02940261095452569,Smik:0.08380370825842257):0.015640290731517764,(Sbay:0.038489186677349164,Skud:0.038489186677349164):0.060954812312591165); Ave=-159.81967227297005; ((Smik:0.07802648460532205,(Scer:0.04734369459293139,Spar:0.04734369459293139):0.03068279001239066):0.012243968912293374,(Skud:0.0399365140411103,Sbay:0.0399365140411103):0.05033393947650512);
Rank = 1; Size = 16; Percent = 0.390243; MAP = -150.1407504811838:(Smik:0.08832671142241318,((Sbay:0.0574884656789708,Skud:0.0574884656789708):0.029947862652692656,(Spar:0.05271204611595535,Scer:0.05271204611595535):0.034724282215708106):8.903830907497218E-4); Ave=-171.0422748749801; (Smik:0.09785346027572299,((Sbay:0.040857883347008524,Skud:0.040857883347008524):0.03552943228704832,(Scer:0.055009891356695276,Spar:0.055009891356695276):0.02137742427736157):0.021466144641666143);
......

Total elapsed time : 27.35100 s

Sample Files

The phylogenetic network, gene trees and the hyper-parameter of the population size are logged into files under your home directory or the directory specified by "-dir outDirectory".

  • Phylogenetic Network: ~/outDirectory/network.log
  • Hyper-parameter of Population size: ~/outDirectory/popSizePrior.log
  • Gene tree: ~/outDirectory/tree_locusName.log

Downloads

  • example.zip
    • example.nexus: input file for PhyloNet
    • example.txt: system output
    • network.log, popSizePrior.log, tree_YAL053W.log, tree_YAR007C.log, tree_YBL015W.log: sample files
  • The yeast data set (Rokas et al., 2003) sampled from seven Saccharomyces species S. cerevisiae (Scer), S. paradoxus (Spar), S. mikatae (Smik), S. kudriavzevii (Skud), S. bayanus (Sbay), S. castellii (Scas) and S. kluyveri (Sklu)
    • 106-locus
    • 28-locus (with strong phylogenetic signals)
    • 106-locus restricted by five Saccharomyces species ScerSparSmikSkud and Sbay.
  • The wheat data set (Marcussen et al., 2014) sampled from hexaploid bread wheat subgenomes T. aestivum TaA (A subgenome), TaB (B subgenome) and TaD (D subgenome), and five diploid relatives T. monococcum (Tm), T. urartu (Tu), Ae. sharonensis (Ash), Ae. speltoides (Asp) and Ae. tauschii (At)
  • The mosquito data set (Fontaine et al., 2014) sampled from six Anopheles species An. gambiae (G), An. coluzzii (C), An. arabiensis (A), An. quadriannulatus (Q), An. merus (R) and An. melas (L)
    • 228-locus from X chromosome
    • 59-locus (with strong phylogenetic signals) from X chromosome
    • 382-locus (with strong phylogenetic signals) from autosomes

Command References

  1. D.Wen and L. Nakhleh. Co-estimating reticulate phylogenies and gene trees on sequences from multiple independent loci. Submitted
  2. Gronau, Ilan, et al. Bayesian inference of ancient human demography from individual genome sequences. Nature genetics 43.10 (2011): 1031-1034.

See Also

  • No labels